Transcription levels of some genes involved in starch metabolism in ChlreSEX4 overexpressing algal lines

Version 1.0

Torresi, Florencia; Carrillo, Julieta Beatriz; Gomez-Casati, Diego Fabián; Busi, Maria V.; Martín, Mariana, 2024, "Transcription levels of some genes involved in starch metabolism in ChlreSEX4 overexpressing algal lines", https://doi.org/10.57715/UNR/5TSEDO, RDA UNR, V1, UNF:6:bGlHIV4hObAsW7mDFL7Eiw== [fileUNF]

Learn about Data Citation Standards.

Contact Owner

Dataset Metrics

718 Views

25 Downloads

0 Citations

Description	The presented dataset illustrates the transcriptional levels of select genes implicated in starch metabolism within ChlreSEX4 overexpressing algal strains. The analysis of gene expression levels was conducted with the aim of elucidating the impact of upregulating a glucan phosphatase enzyme within the chloroplast of green algae. The file displays tables with the relative expression for each studied gene in different algal lines (WT, 13, 24, and 48), with each gene shown in different colors. The column "SAMPLE NAME" indicates which algal line is being analyzed. The column "TARGET NAME" indicates which gene is being analyzed, including its name and its ORF name. The column "CT" shows the Ct value obtained after qRT-PCR for each gene and each algal line, using the StepOnePlus Real-Time PCR System under the following conditions: 2 min denaturation at 94 °C; 40 cycles at 94 °C for 10 s, 60 °C for 15 s, and 72 °C for 20 s, followed by 10 min extension at 72 °C. Three replicates were performed for each sample and each gene. The column "AVERAGE CT" shows the average Ct obtained for the EEF1A gene in each line, which is used as an internal control. The column "DELTA CT" is the difference between the Ct for the specific gene under study and the average Ct for the EEF1A gene in each algal line. The column "2^-DELTA CT" is the result of calculating 2^-DELTA CT for each gene in each line. The column "average exp" is the average 2^-DELTA CT value obtained for each gene for each algal line. The column "relative expression" is the individual value of 2^-DELTA CT obtained for each gene and each line after considering the average 2^-DELTA CT for that gene in the WT line as 1. Methodology. Total RNA was extracted from Chlamydomonas reinhardtii cells using TRI reagent (Molecular Research Center, Inc, USA) according to the manufacturer's instructions. RNA quality was determined by agarose gel electrophoresis, and its concentration was determined on the Microplate Spectrophotometer. The first strand cDNAs were synthesized by M-MLV reverse transcriptase (Promega, Fitchburg,WI, USA) and an oligo-dT 18 primer. Pair of primers for qRT-PCR were: AGPaseFw (GTGATGGAGAGCAGACGGAGGT) and AGPaseRv (CTCGCTTCAACAGTACCCGAGC) for transcript STA6AGPase (CHLRE_03g188250v5 transcript locus); GBSSIFw (GTGACTGTGTCGCCCAACTACG) and GBSSI Rv (AGGAACTTGTCGGTCTTGGGGT) for transcript GBSSI (locus CHLRE_17g721500v5); SSII Fw (GGACGCACTGTGACATACGCTT) and SSII Rv (CTTCAAGCCCACACGCCCTAAC) for transcript SSII (locus CHLRE_03g185250v5); SBE2 Fw (GTACAAGTGGCTGCTGGCCTTC) and SBE2 Rv (GGGTGGGGTGGAAGTTGAACAC) for transcript SBE2 (locus CHLRE_06g270100v5); GWD2 Fw (CTACGACGAGCCGTTCCTGGAG) and GWD2 Rv (CGTGATATGGTCAATCCCCTCCCC) for transcript GWD2 (locus CHLRE_07g332300v5); PWD Fw (CATCGCCAACTTCTCCACGGC) and PWD Rv (TAGTCCACTTCCCGGTCCACCA) for transcript PWD (locus CHLRE_17g719900v5); AMY2 Fw (CTTGAGCAGTTGGGAGAGGCGA) and AMY2 Rv (CGTTCATGCACCCGAATAGCGG) for transcript AMY2 (locus CHLRE_08g362450v5); and, EEF1 UP (CTAGGATGCTAACCGCGCAAGAG) and EEF1 DW (AACAGCGAAGCTCCACGCAC) for transcript EEF1 (Eukaryotic translation Elongation Factor 1 alpha 2 (CHLRE_12g498600v5)). EEF1 was used as an internal control and the relative expression ratio was calculated as described in Pfaffl, M. W. (2001). The entire process of qRT-PCR was carried out with The StepOnePlus Real-Time PCR System under the following conditions: 2 min denaturation at 94 °C; 40 cycles at 94 °C for 10 s, 60 °C for 15 s, and 72 °C for 20 s, followed by 10 min extension at 72 °C. Three replicates were performed for each sample. Melt curve analysis was conducted to confirm the specificity of each assay. Value of the data: The transcription levels of some genes involved in starch metabolism were analyzed and may contribute to gain insight into the intricately regulated mechanism of starch synthesis/degradation and phosphorylation/dephosphorylation in vivo. Descripción: El conjunto de datos presentado ilustra los niveles transcripcionales de algunos genes involucrados en el metabolismo del almidón en cepas de algas que sobreexpresan ChlreSEX4. El análisis de los niveles de expresión genética se realizó con el objetivo de dilucidar el impacto de la sobreexpresión de una enzima glucano fosfatasa en cloroplastos de algas verdes. El archivo muestra tablas con la expresión relativa de cada gen estudiado en diferentes líneas de algas (WT, 13, 24 y 48), y cada gen se muestra en diferentes colores. La columna "SAMPLE NAME" indica qué línea de algas se está analizando. La columna "TARGET NAME" indica qué gen se está analizando, incluido su nombre y su nombre ORF. La columna "CT" muestra el valor de Ct obtenido después de qRT-PCR para cada gen y cada línea de alga, utilizando el sistema de PCR en tiempo real StepOnePlus en las siguientes condiciones: desnaturalización de 2 min a 94 °C; 40 ciclos a 94 °C durante 10 s, 60 °C durante 15 s y 72 °C durante 20 s, seguidos de 10 min de extensión a 72 °C. Se realizaron tres réplicas para cada muestra y cada gen. La columna "AVERAGE CT" muestra el Ct promedio obtenido para el gen EEF1A en cada línea, que se utiliza como control interno. La columna "DELTA CT" es la diferencia entre el Ct del gen específico en estudio y el Ct promedio del gen EEF1A en cada línea de algas. La columna "2^-DELTA CT" es el resultado de calcular 2^-DELTA CT para cada gen en cada línea. La columna "average exp" es el valor promedio de 2 ^ -DELTA CT obtenido para cada gen para cada línea de algas. La columna "relative expression" es el valor individual de 2^-DELTA CT obtenido para cada gen y cada línea después de considerar el 2^-DELTA CT promedio para ese gen en la línea WT como 1. Metodología: El ARN total se extrajo de células de Chlamydomonas reinhardtii utilizando el reactivo TRI (Molecular Research Center, Inc, EE. UU.) según las instrucciones del fabricante. La calidad del ARN se determinó mediante electroforesis en gel de agarosa y su concentración se determinó espectrofotómetricamente. El ADNc se sintetizó mediante la transcriptasa inversa M-MLV (Promega, Fitchburg, WI, EE. UU.) y un cebador oligo-dT 18. Los pares de cebadores utilizados para qRT-PCR se describen a continuación: AGPaseFw (GTGATGGAGAGCAGACGGAGGT) y AGPaseRv (CTCGCTTCAACAGTACCCGAGC) para el gen de STA6AGPasa (locus de transcripción CHLRE_03g188250v5); GBSSIFw (GTGACTGTGTCGCCCAACTACG) y GBSSI Rv (AGGAACTTGTCGGTCTTGGGGT) para el gen de GBSSI (locus CHLRE_17g721500v5); SSII Fw (GGACGCACTGTGACATACGCTT) y SSII Rv (CTTCAAGCCCACACGCCCTAAC) para el gen de SSII (locus CHLRE_03g185250v5); SBE2 Fw (GTACAAGTGGCTGCTGGCCTTC) y SBE2 Rv (GGGTGGGGTGGAAGTTGAACAC) para el gen de SBE2 (locus CHLRE_06g270100v5); GWD2 Fw (CTACGACGAGCCGTTCCTGGAG) y GWD2 Rv (CGTGATATGGTCAATCCCCTCCCC) para el gen de GWD2 (locus CHLRE_07g332300v5); PWD Fw (CATCGCCAACTTCTCCACGGC) y PWD Rv (TAGTCCACTTCCCGGTCCCACCA) para el gen de PWD (locus CHLRE_17g719900v5); AMY2 Fw (CTTGAGCAGTTGGGAGAGGCGA) y AMY2 Rv (CGTTCATGCACCCGAATAGCGG) para el gen de AMY2 (locus CHLRE_08g362450v5); y EEF1 UP (CTAGGATGCTAACCGCGCAAGAG) y EEF1 DW (AACAGCGAAGCTCCACGCAC) para el gen de EEF1 (factor de elongación de traducción eucariótica 1 alfa 2 (CHLRE_12g498600v5)). Se usó EEF1 como control interno y la relación de expresión relativa se calculó como se describe en Pfaffl, M. W. (2001). Todo el proceso de qRT-PCR se llevó a cabo con el sistema de PCR en tiempo real StepOnePlus en las siguientes condiciones: desnaturalización de 2 min a 94 °C; 40 ciclos a 94 °C durante 10 s, 60 °C durante 15 s y 72 °C durante 20 s, seguidos de 10 min de extensión a 72 °C. Se realizaron tres réplicas para cada muestra. Se realizó un análisis de la curva de fusión para confirmar la especificidad de cada ensayo. Valor de los datos: Se analizaron los niveles de transcripción de algunos genes implicados en el metabolismo del almidón y que pueden contribuir a comprender mejor el complejo mecanismo de regulación de la síntesis/degradación y la fosforilación/desfosforilación del almidón in vivo.
Subject	Other; Medicine, Health and Life Sciences
Keyword	starch metabolism, algae, ChlreSEX4, Transcription, Genetic, Starch / metabolism, DNA, Algal, RNA, Algal, Chlamydomonas reinhardtii, Transcripción Genética, Almidón / metabolismo, ADN de Algas, ARN de Algas
Related Publication	Carrillo, J. B., Torresi, F., Morales, L. L., Ricordi, M., Gomez-Casati, D. F., Busi, M. V., & Martín, M. (2020). Identification and characterization of ChlreSEX4, a novel glucan phosphatase from Chlamydomonas reinhardtii green alga. Archives of biochemistry and biophysics, 680, 108235. doi: 10.1016/j.abb.2019.108235
License/Data Use Agreement	CC BY 4.0

Filter by

	1 to 2 of 2 Files	Original Format Archival Format (.tab)
	02_README.txt Plain Text - 9.8 KB Published Apr 24, 2024 14 Downloads MD5: 4681c7ce39772cf1830b9bc4474eb8d8	Preview "02_README.txt" Access File File Access Public Download Options Plain Text Download Metadata Data File Citation EndNote XML RIS BibTeX
	01_Transcription_levels_of_some_genes_involved_in_starch_metabolism_in_ChlreSEX4_overexpressing_algal_lines.tab Tabular Data - 18.8 KB Published Apr 24, 2024 13 Downloads 18 Variables, 103 Observations UNF:6:bGlHIV4hObAsW7mDFL7Eiw== The file displays tables with the relative expression for each studied gene in different algal lines (WT, 13, 24, and 48), with each gene shown in different colors. The column "SAMPLE NAME" indicates which algal line is being analyzed. The column "TARGET NAME" indicates which gene is being analyzed, including its name and its ORF name. The column "CT" shows the Ct value obtained after qRT-PCR for each gene and each algal line, using the StepOnePlus Real-Time PCR System under the following conditions: 2 min denaturation at 94 °C; 40 cycles at 94 °C for 10 s, 60 °C for 15 s, and 72 °C for 20 s, followed by 10 min extension at 72 °C. Three replicates were performed for each sample and each gene. The column "AVERAGE CT" shows the average Ct obtained for the EEF1A gene in each line, which is used as an internal control. The column "DELTA CT" is the difference between the Ct for the specific gene under study and the average Ct for the EEF1A gene in each algal line. The column "2^-DELTA CT" is the result of calculating 2^-DELTA CT for each gene in each line. The column "average exp" is the average 2^-DELTA CT value obtained for each gene for each algal line. The column "relative expression" is the individual value of 2^-DELTA CT obtained for each gene and each line after considering the average 2^-DELTA CT for that gene in the WT line as 1.	Preview "01_Transcription_levels_of_some_genes_involved_in_starch_metabolism_in_ChlreSEX4_overexpressing_algal_lines.tab" Access File File Access Public Download Options MS Excel Spreadsheet (Original File Format) Tab-Delimited RData Download Metadata Variable Metadata Data File Citation EndNote XML RIS BibTeX

Citation Metadata

Dataset Persistent ID	doi:10.57715/UNR/5TSEDO
Publication Date	2024-04-24
Title	Transcription levels of some genes involved in starch metabolism in ChlreSEX4 overexpressing algal lines
Alternative Title	Niveles de transcripción de algunos genes implicados en el metabolismo del almidón en líneas algales sobreexpresantes para ChlreSEX4
Author	Torresi, Florencia (Universidad Nacional de Rosario. Facultad de Ciencias Bioquímicas y Farmacéuticas. Centro de Estudios Fotosintéticos y Bioquímicos CEFOBI-CONICET; Argentina) - ScopusID: 57204036207 Carrillo, Julieta Beatriz (Universidad Nacional de Rosario. Facultad de Ciencias Bioquímicas y Farmacéuticas. Centro de Estudios Fotosintéticos y Bioquímicos CEFOBI-CONICET; Argentina) - ScopusID: 56943011800 Gomez-Casati, Diego Fabián (Universidad Nacional de Rosario. Facultad de Ciencias Bioquímicas y Farmacéuticas. Centro de Estudios Fotosintéticos y Bioquímicos CEFOBI-CONICET; Argentina) - ORCID: 0000-0002-4569-2579 Busi, Maria V. (Universidad Nacional de Rosario. Facultad de Ciencias Bioquímicas y Farmacéuticas. Centro de Estudios Fotosintéticos y Bioquímicos CEFOBI-CONICET; Argentina) - ORCID: 0000-0003-3638-7043 Martín, Mariana (Universidad Nacional de Rosario. Facultad de Ciencias Bioquímicas y Farmacéuticas. Centro de Estudios Fotosintéticos y Bioquímicos CEFOBI-CONICET; Argentina) - ORCID: 0000-0002-4444-4901
Contact	Use email button above to contact. Martín, Mariana (Universidad Nacional de Rosario. Facultad de Ciencias Bioquímicas y Farmacéuticas. Centro de Estudios Fotosintéticos y Bioquímicos CEFOBI-CONICET; Argentina)
Description	The presented dataset illustrates the transcriptional levels of select genes implicated in starch metabolism within ChlreSEX4 overexpressing algal strains. The analysis of gene expression levels was conducted with the aim of elucidating the impact of upregulating a glucan phosphatase enzyme within the chloroplast of green algae. The file displays tables with the relative expression for each studied gene in different algal lines (WT, 13, 24, and 48), with each gene shown in different colors. The column "SAMPLE NAME" indicates which algal line is being analyzed. The column "TARGET NAME" indicates which gene is being analyzed, including its name and its ORF name. The column "CT" shows the Ct value obtained after qRT-PCR for each gene and each algal line, using the StepOnePlus Real-Time PCR System under the following conditions: 2 min denaturation at 94 °C; 40 cycles at 94 °C for 10 s, 60 °C for 15 s, and 72 °C for 20 s, followed by 10 min extension at 72 °C. Three replicates were performed for each sample and each gene. The column "AVERAGE CT" shows the average Ct obtained for the EEF1A gene in each line, which is used as an internal control. The column "DELTA CT" is the difference between the Ct for the specific gene under study and the average Ct for the EEF1A gene in each algal line. The column "2^-DELTA CT" is the result of calculating 2^-DELTA CT for each gene in each line. The column "average exp" is the average 2^-DELTA CT value obtained for each gene for each algal line. The column "relative expression" is the individual value of 2^-DELTA CT obtained for each gene and each line after considering the average 2^-DELTA CT for that gene in the WT line as 1. Methodology. Total RNA was extracted from Chlamydomonas reinhardtii cells using TRI reagent (Molecular Research Center, Inc, USA) according to the manufacturer's instructions. RNA quality was determined by agarose gel electrophoresis, and its concentration was determined on the Microplate Spectrophotometer. The first strand cDNAs were synthesized by M-MLV reverse transcriptase (Promega, Fitchburg,WI, USA) and an oligo-dT 18 primer. Pair of primers for qRT-PCR were: AGPaseFw (GTGATGGAGAGCAGACGGAGGT) and AGPaseRv (CTCGCTTCAACAGTACCCGAGC) for transcript STA6AGPase (CHLRE_03g188250v5 transcript locus); GBSSIFw (GTGACTGTGTCGCCCAACTACG) and GBSSI Rv (AGGAACTTGTCGGTCTTGGGGT) for transcript GBSSI (locus CHLRE_17g721500v5); SSII Fw (GGACGCACTGTGACATACGCTT) and SSII Rv (CTTCAAGCCCACACGCCCTAAC) for transcript SSII (locus CHLRE_03g185250v5); SBE2 Fw (GTACAAGTGGCTGCTGGCCTTC) and SBE2 Rv (GGGTGGGGTGGAAGTTGAACAC) for transcript SBE2 (locus CHLRE_06g270100v5); GWD2 Fw (CTACGACGAGCCGTTCCTGGAG) and GWD2 Rv (CGTGATATGGTCAATCCCCTCCCC) for transcript GWD2 (locus CHLRE_07g332300v5); PWD Fw (CATCGCCAACTTCTCCACGGC) and PWD Rv (TAGTCCACTTCCCGGTCCACCA) for transcript PWD (locus CHLRE_17g719900v5); AMY2 Fw (CTTGAGCAGTTGGGAGAGGCGA) and AMY2 Rv (CGTTCATGCACCCGAATAGCGG) for transcript AMY2 (locus CHLRE_08g362450v5); and, EEF1 UP (CTAGGATGCTAACCGCGCAAGAG) and EEF1 DW (AACAGCGAAGCTCCACGCAC) for transcript EEF1 (Eukaryotic translation Elongation Factor 1 alpha 2 (CHLRE_12g498600v5)). EEF1 was used as an internal control and the relative expression ratio was calculated as described in Pfaffl, M. W. (2001). The entire process of qRT-PCR was carried out with The StepOnePlus Real-Time PCR System under the following conditions: 2 min denaturation at 94 °C; 40 cycles at 94 °C for 10 s, 60 °C for 15 s, and 72 °C for 20 s, followed by 10 min extension at 72 °C. Three replicates were performed for each sample. Melt curve analysis was conducted to confirm the specificity of each assay. Value of the data: The transcription levels of some genes involved in starch metabolism were analyzed and may contribute to gain insight into the intricately regulated mechanism of starch synthesis/degradation and phosphorylation/dephosphorylation in vivo. Descripción: El conjunto de datos presentado ilustra los niveles transcripcionales de algunos genes involucrados en el metabolismo del almidón en cepas de algas que sobreexpresan ChlreSEX4. El análisis de los niveles de expresión genética se realizó con el objetivo de dilucidar el impacto de la sobreexpresión de una enzima glucano fosfatasa en cloroplastos de algas verdes. El archivo muestra tablas con la expresión relativa de cada gen estudiado en diferentes líneas de algas (WT, 13, 24 y 48), y cada gen se muestra en diferentes colores. La columna "SAMPLE NAME" indica qué línea de algas se está analizando. La columna "TARGET NAME" indica qué gen se está analizando, incluido su nombre y su nombre ORF. La columna "CT" muestra el valor de Ct obtenido después de qRT-PCR para cada gen y cada línea de alga, utilizando el sistema de PCR en tiempo real StepOnePlus en las siguientes condiciones: desnaturalización de 2 min a 94 °C; 40 ciclos a 94 °C durante 10 s, 60 °C durante 15 s y 72 °C durante 20 s, seguidos de 10 min de extensión a 72 °C. Se realizaron tres réplicas para cada muestra y cada gen. La columna "AVERAGE CT" muestra el Ct promedio obtenido para el gen EEF1A en cada línea, que se utiliza como control interno. La columna "DELTA CT" es la diferencia entre el Ct del gen específico en estudio y el Ct promedio del gen EEF1A en cada línea de algas. La columna "2^-DELTA CT" es el resultado de calcular 2^-DELTA CT para cada gen en cada línea. La columna "average exp" es el valor promedio de 2 ^ -DELTA CT obtenido para cada gen para cada línea de algas. La columna "relative expression" es el valor individual de 2^-DELTA CT obtenido para cada gen y cada línea después de considerar el 2^-DELTA CT promedio para ese gen en la línea WT como 1. Metodología: El ARN total se extrajo de células de Chlamydomonas reinhardtii utilizando el reactivo TRI (Molecular Research Center, Inc, EE. UU.) según las instrucciones del fabricante. La calidad del ARN se determinó mediante electroforesis en gel de agarosa y su concentración se determinó espectrofotómetricamente. El ADNc se sintetizó mediante la transcriptasa inversa M-MLV (Promega, Fitchburg, WI, EE. UU.) y un cebador oligo-dT 18. Los pares de cebadores utilizados para qRT-PCR se describen a continuación: AGPaseFw (GTGATGGAGAGCAGACGGAGGT) y AGPaseRv (CTCGCTTCAACAGTACCCGAGC) para el gen de STA6AGPasa (locus de transcripción CHLRE_03g188250v5); GBSSIFw (GTGACTGTGTCGCCCAACTACG) y GBSSI Rv (AGGAACTTGTCGGTCTTGGGGT) para el gen de GBSSI (locus CHLRE_17g721500v5); SSII Fw (GGACGCACTGTGACATACGCTT) y SSII Rv (CTTCAAGCCCACACGCCCTAAC) para el gen de SSII (locus CHLRE_03g185250v5); SBE2 Fw (GTACAAGTGGCTGCTGGCCTTC) y SBE2 Rv (GGGTGGGGTGGAAGTTGAACAC) para el gen de SBE2 (locus CHLRE_06g270100v5); GWD2 Fw (CTACGACGAGCCGTTCCTGGAG) y GWD2 Rv (CGTGATATGGTCAATCCCCTCCCC) para el gen de GWD2 (locus CHLRE_07g332300v5); PWD Fw (CATCGCCAACTTCTCCACGGC) y PWD Rv (TAGTCCACTTCCCGGTCCCACCA) para el gen de PWD (locus CHLRE_17g719900v5); AMY2 Fw (CTTGAGCAGTTGGGAGAGGCGA) y AMY2 Rv (CGTTCATGCACCCGAATAGCGG) para el gen de AMY2 (locus CHLRE_08g362450v5); y EEF1 UP (CTAGGATGCTAACCGCGCAAGAG) y EEF1 DW (AACAGCGAAGCTCCACGCAC) para el gen de EEF1 (factor de elongación de traducción eucariótica 1 alfa 2 (CHLRE_12g498600v5)). Se usó EEF1 como control interno y la relación de expresión relativa se calculó como se describe en Pfaffl, M. W. (2001). Todo el proceso de qRT-PCR se llevó a cabo con el sistema de PCR en tiempo real StepOnePlus en las siguientes condiciones: desnaturalización de 2 min a 94 °C; 40 ciclos a 94 °C durante 10 s, 60 °C durante 15 s y 72 °C durante 20 s, seguidos de 10 min de extensión a 72 °C. Se realizaron tres réplicas para cada muestra. Se realizó un análisis de la curva de fusión para confirmar la especificidad de cada ensayo. Valor de los datos: Se analizaron los niveles de transcripción de algunos genes implicados en el metabolismo del almidón y que pueden contribuir a comprender mejor el complejo mecanismo de regulación de la síntesis/degradación y la fosforilación/desfosforilación del almidón in vivo.
Subject	Other; Medicine, Health and Life Sciences
Keyword	starch metabolism, algae ChlreSEX4 Transcription, Genetic (MeSH) https://www.ncbi.nlm.nih.gov/mesh?size=200&term=Transcription%2C+Genetic Starch / metabolism (MeSH) https://www.ncbi.nlm.nih.gov/mesh/68013213 DNA, Algal (MeSH) https://www.ncbi.nlm.nih.gov/mesh/68048028 RNA, Algal (MeSH) https://www.ncbi.nlm.nih.gov/mesh/68048030 Chlamydomonas reinhardtii (MeSH) https://www.ncbi.nlm.nih.gov/mesh/68016825 Transcripción Genética (DeCS) https://decs.bvsalud.org/es/ths?filter=ths_termall&q=Transcription%2C+Genetic Almidón / metabolismo (DeCS) https://decs.bvsalud.org/es/ths/resource/?id=13598&filter=ths_termall&q=Starch ADN de Algas (DeCS) https://decs.bvsalud.org/es/ths/resource/?id=13598&filter=ths_termall&q=Starch ARN de Algas (DeCS) https://decs.bvsalud.org/es/ths/resource/?id=38784&filter=ths_termall&q=RNA,%20Algal
Topic Classification	Ciencias biológicas (FORD) https://purl.org/becyt/ford/1.6 Ciencias de la salud (FORD) https://purl.org/becyt/ford/3.3
Related Publication	Carrillo, J. B., Torresi, F., Morales, L. L., Ricordi, M., Gomez-Casati, D. F., Busi, M. V., & Martín, M. (2020). Identification and characterization of ChlreSEX4, a novel glucan phosphatase from Chlamydomonas reinhardtii green alga. Archives of biochemistry and biophysics, 680, 108235. doi: 10.1016/j.abb.2019.108235 https://doi.org/10.1016/j.abb.2019.108235
Language	English
Grant Information	Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET): PIP 11220200103068CO Agencia Nacional de Promoción Científica y Tecnológica: PICT 2019-1771 Universidad Nacional de Rosario: 80020180300092UR
Depositor	Martín, Mariana
Deposit Date	2024-04-15
Date of Collection	Start: 2021 ; End: 2023
Kind of Data	Gene expression data; Datos de expresión génica
Software	Microsoft Excel

Life Sciences Metadata

Design Type	Other
Other Design Type	Comparative study; Estudio comparativo
Factor Type	Other
Other Factor Type	Experimental group: Transforming algae that overexpress the ChlreSEX4 gene. Control group: Wild type algae.; Grupo experimental: Algas transformantes que sobreexpresan el gen ChlreSEX4. Grupo control: Algas tipo salvaje.
Organism	Chlamydomonas reinhardtii; Other
Other Organism	Chlamydomonas reinhardtii CC-1690
Measurement Type	Other
Other Measurement Type	Gene expression profiling; Perfiles de expresión génica
Technology Type	real time PCR; Other
Other Technology Type	Espectrofotometría
Technology Platform	Other
Other Technology Platform	EPOCH 2 Microplate Spectrophotometer (BioTek Instruments, Inc., USA); StepOnePlus Real-Time PCR System (Applied Biosystems, USA)
Cell Type	Algal cells

Dataset Terms

License/Data Use Agreement

Our Community Norms as well as good scientific practices expect that proper credit is given via citation. Please use the data citation shown on the dataset page.

Creative Commons Attribution 4.0 International License. CC BY 4.0

Dataset Version	Summary	Contributors	Published on
No records found.

Edit File

This file has already been deleted (or replaced) in the current version. It may not be edited.

Restrict Files

Restricting limits access to published files. You can add or edit Terms of Access for Restricted Files and allow people to Request Access to those files.

Terms of Access for Restricted Files

Request Access

Enable access request

Edit Embargo

The selected file or files have already been published. Contact an administrator to change the embargo date or reason of the file or files.

Delete Files

The file will be deleted after you click on the Delete button.

Files will not be removed from previously published versions of the dataset.

Select File(s)

Please select one or more files.

Share Dataset

Share this dataset on your favorite social media networks.

Dataset Citations

Citations for this dataset are retrieved from Crossref via DataCite using Make Data Count standards. For more information about dataset metrics, please refer to the User Guide.

Sorry, no citations were found.

Restricted Files Selected

The selected file(s) may not be downloaded because you have not been granted access.

Download Options

The files selected are too large to download as a ZIP.

You can select individual files that are below the 100.0 MB download limit from the files table, or use the Data Access API for programmatic access to the files.

Select File(s)

Please select a file or files to be downloaded.

Restricted Files Selected

The restricted file(s) selected may not be downloaded because you have not been granted access.

Click Continue to download the files you have access to download.

Delete Dataset

Are you sure you want to delete this dataset and all of its files? You cannot undelete this dataset.

Delete Draft Version

Are you sure you want to delete this draft version? Files will be reverted to the most recently published version. You cannot undelete this draft.

Unpublished Dataset Private URL

Private URL can only be used with unpublished versions of datasets.

Unpublished Dataset Private URL

Are you sure you want to disable the Private URL? If you have shared the Private URL with others they will no longer be able to use it to access your unpublished dataset.

Delete Files

The file(s) will be deleted after you click on the Delete button.

Files will not be removed from previously published versions of the dataset.

Compute

This dataset contains restricted files you may not compute on because you have not been granted access.

Deaccession Dataset

Are you sure you want to deaccession? The selected version(s) will no longer be viewable by the public.

Deaccession Dataset

Are you sure you want to deaccession this dataset? It will no longer be viewable by the public.

Version Differences Details

Please select two versions to view the differences.

Version Differences Details

Version:
Last Updated:

Select File(s)

Please select a file or files for access request.

Select File(s)

Embargoed files cannot be accessed. Please select an unembargoed file or files for your access request.

Edit Tags

Select existing file tags or create new tags to describe your files. Each file can have more than one tag.

Request Access

You need to Sign Up or Log In to request access.

Dataset Terms

This dataset is made available under the following terms. Please confirm and/or complete the information needed below in order to continue.

License/Data Use Agreement

Our Community Norms as well as good scientific practices expect that proper credit is given via citation. Please use the data citation shown on the dataset page.

Creative Commons Attribution 4.0 International License. CC BY 4.0

Preview Guestbook

Upon downloading files the guestbook asks for the following information.

Guestbook Name

Collected Data

Account Information

Package File Download

Use the Download URL in a Wget command or a download manager to download this package file. Download via web browser is not recommended. User Guide - Downloading a Dataverse Package via URL

Download URL

https://dataverse.unr.edu.ar/api/access/datafile/

Request Access

Please confirm and/or complete the information needed below in order to request access to files in this dataset.

Compute Batch

Clear Batch

Dataset	Dataset Persistent ID	Change Compute Batch

Compute Batch

Submit for Review

You will not be able to make changes to this dataset while it is in review.

Publish Dataset

Are you sure you want to republish this dataset?

Select if this is a minor or major version update.

Minor Release (1.1)

Major Release (2.0)

License/Data Use Agreement

Creative Commons Attribution 4.0 International License. CC BY 4.0

License Description

Creative Commons Attribution 4.0 International License.

Publish Dataset

This dataset cannot be published until Facultad de Ciencias Bioquímicas y Farmacéuticas is published by its administrator.

Publish Dataset

This dataset cannot be published until Facultad de Ciencias Bioquímicas y Farmacéuticas and RDA UNR are published.

Return to Author

Return this dataset to contributor for modification.